000285   WanHafizah W J;et al (Institute of Medical Molecular Biotechnology, Faculty of Medicine, Teknologi MARA Univ, Sungai Buloh, Campus, 47000 Sungai Buloh, Selangor, Malaysia) : Organization of cytoskeleton and chromatin is related to the timing of the first zygotic cleavage and early developmental competence. Biomed Res 2015, 26(2), 286-92.

Timing of the first zygotic cleavage is a reliable predictor of embryo quality. Embryos that cleave early have higher developmental viability compared to their late counterparts. It is hypothesized that differences in viability is attributed to cytoskeletal and chromatin organizations. This study investigated cytoskeletal and chromatin structures, and distributions in earlycleaving (EC) versus late-cleaving (LC) embryos. Embryos were retrieved from superovulated ICR mice, 28 hours after hCG injection. Two-cell stage embryos were categorized as EC, while zygotes with two pronuclei as LC embryos. After overnight culture in M16 medium, embryos were fixed and immunostained to visualize cytoskeletal and chromatin distributions, and intensities. EC embryos were observed to have significantly higher actin and chromatin fluorescence intensities compared to LC embryos [(14.68 + 14.07) x 10⁵ versus (1.50 + 1.20) x 10⁵ pixels (p<60>0.05) and (11.43 + 3.48) x 10⁵ versus (7.98 + 3.08) x 10⁵ pixels (p<60>0.05)], respectively. There was no significant difference in tubulin intensity between EC and LC embryos. This suggests that higher densities of actin and chromatin in EC embryos appreciably contributed to more efficient cell division and therefore, greater developmental competence.

6 illus, 1 table, 22 ref

000284   Wang H;Shen W;Liu H;Zhang L;Huang S (NO, Liaoning NuoKang Bio-Pharmaceutical Co.Ltd, Shenyang 110011, P.R. China) : Study of the anti-motion sickness action of volatile oilm constituents in Pinellia ternate. Biomed Res 2015, 26(2), 230-4.

The objective of the study is to observe the anti-motion sickness effect of volatile oil extract of Pinelia ternata in rats, compare the strength of anti-motion sickness action between the Pinelia ternata volatile oil extract and the dimenhydrinate, and analyze the constituents in volatile oil of Pinelia ternata. Rats with frequency is 0.05Hz, the peak speed of 240°/s2 rotated to stimulate, evoked kaolin behavior and conditioned anorexia, motion sickness severity was judged by kaolin intake and tired of drinking behavior of saccharin water. Intragastric administration of each drug group, observe inhibition on rat kaolin behavior and the rotation stimulation before and after stimulation of 0.15% saccharin drinking water continuous 3D output in 24h. Chemical constituents in volatile oil of Pinelia ternata were analyzed by capillary gas chromatographymass spectrometry (GC-MS). Results: After administration of Pinelia ternata volatile oil, kaolin intake was significantly lower than rats in the model group, Pinelia ternata extract could promote the drinking of saccharin solution, while there was no significant difference between the dimenhydrinate group and the model group. GC-MS analysis showed that volatile oil of Pinelia ternata mainly contained 15 chemical constituents. Conclusion: Chemical constituents in volatile oil of Pinelia ternata had a significant effect against motion sickness.

1 illus, 2 tables, 18 ref

000283   Viji N;Chinnamuthu C R;Chinnusamy C (Agronomy Dep, Agricultural College & Research Instt., Madurai-625 104, Email: mathumitha08@gmail.com) : Depriving the purple nutsedge by degrading the starch present in the tubers using immobilized amylase on the surface of organically synthesized silver nanoparticles. Green Fmg 2016, 7(1), 107-10.

Amylase is one of the important digestive enzymes involved in the hydrolysis of starch. Silver nanoparticles are proven to be an effective catalytic material for various applications due to their excellent optical and electronic properties. A laboratory experiment is carried out at the Department of Nano Science and Technology, Tamil Nadu Agricultural University to study the catalytic activity of hydrolytic enzyme α- amylase and synthesized silver nanoparticles on the degradation process of starch stored in the Cyperus rotundus tubers. The silver nanoparticles are synthesized by soluble starch reducing silver nitrate to silver atoms and were characterized by UV-Vis spectroscopy, Fourier Transform Infrared Spectroscopy (FTIR) and Transmission Electron Microscope (TEM). α-Amylase at the concentration of 500 ppm/kg of tubers recorded higher rate of starch degradation of C. rotundus tubers. It recorded 21.76 per cent of starch degradation over control. Silver nanoparticles at the concentration of 2.5 g/kg of tubers recorded 7.3 per cent of starch degradation over control. α-Amylase + silver nanoparticles at the concentration of 500 ppm + 2.5 g/kg of tubers, respectively recorded 25.31 per cent of starch degradation over control. Starch synthesized silver nanoparticles showed an increased rate of reaction with α-amylase. The degradation of starch digestion kinetics in the presence of silver nanoparticles rapidly produced larger amounts of reducing sugars. The nanoparticles enhance the basal α-amylase activity leads to effective starch degradation.

3 illus, 3 tables, 9 ref

000282   Ubani O;Atagana H F;Thantsha M S;Adeleke R (Environmental Sciences Dep, South Africa Pretoria Univ, 0003, South Africa, Email: 43473343@mylife.unisa.ac.za) : Characterisation of oil degrading bacteria from tailored compost containing crude oil sludge. Indian J Biotechnol 2016, 15(2), 243-50.

In the present study, different bacteria with polycyclic aromatic hydrocarbon (PAH)-degrading capabilities were isolated from compost prepared from oil sludge and animal manures. These bacteria were isolated on a mineral base medium and mineral salt agar plates. A total of 31 morphologically distinct isolates were carefully selected from 5 different compost treatments for identification using polymerase chain reaction (PCR) of the 16S rRNA gene with specific primers (16S-P1 PCR (5'AGAGTTTGATCCTGGCTCAG3') and 16S-P2 PCR (5'AAGGAGGTGATCCAGCCGCA3'). The amplicons were sequenced using 16S-PA SEQ (5/CTACGGGAGGCAGCAG3/) and sequences were compared with the known nucleotides from the GenBank. The phylogenetic analyses of the isolates showed that they belong to 3 different clades: Firmicutes, Proteobacteria and Actinobacteria. The bacteria identified were closely related to the genera Bacillus, Arthrobacter, Staphylococcus, Brevibacterium, Variovorax, Paenibacillus, Ralstonia and Geobacillus. The results showed that Bacillus species were predominant in all composts. Based on the results of the degradation of the PAH in the composts and results of previous studies on bacterial degradation of hydrocarbons in oil, the characteristics of these bacterial isolates suggests that they may be responsible for the breakdown of PAH of different mol wt in the composts. Thus, they may be potentially useful for bioremediation of oil sludge during compost bioremediation.

5 illus, 3 tables, 24 ref

000281   Suyono E A;Nopitasari S;Zusron M;Khoirunnisa P;Islami D A;Prabeswara C B (Laboratory of Biotechnology, Faculty of Biology, Universitas Gadjah Mada, Jl. Teknika Selatan, Sekip Utara, Yogyakarta, Indonesia 55281, Email: eko_suyono@ugm.ac.id) : Effect of silica on carbohydrate content of mixed culture Phaeodactylum sp. and Chlorella sp. Biosci Biotechnol Res Asia 2016, 13(1), 109-14.

Microalgae is one organism that can be used as raw material for bioethanol production. Growth and composition of microalgae cells affected by strain and environmental conditions, including temperature, pH and nutrients. Nutrients are used for the growth of one of silica, except that the silica used to form frustule on diatoms. This study aimed to determine the effect of silica on growth, dry weight, and carbohydrate produced from mixed cultures Phaeodactylum sp. and Chlorella sp. Cultivation is carried out for 21 days on a laboratory scale using a medium F / 2. Culture growth was measured by counting cell density. The dry weight is calculated every 7 days to obtain a biomass productivity. Carbohydrate content was measured by the phenol-sulfuric method. samples were taken on days 0, 7, 14 and 21. It could be concluded that the highest quota of carbohydrate per cell was obtained on Si 90 ppm, accounted for 0.03977 mg / cell. Furthermore, total carbohydrate content and the highest percentage in the mixed culture Phaeodactylum sp. and Chlorella sp. were found in treatment of 30 ppm and 6 ppm, amount of 289.93 mg / L and 40.45%, respectively. Thus the mixed culture was prospective as bioethanol feedstock.

4 illus, 32 ref

000280   Sundararajan B;Mahendran G;Thamaraiselvi R; Ranjitha Kumari B D (Plant Science Dep, Bharathidasan Univ, Tiruchirappalli-620 024) : Biological activity of synthesized silver nanoparticles from Cardiospermum halicacabum L.. Bull Mater Sci 2016, 39(2), 423-31.

The present study focuses on the green synthesis of silver nanoparticles using aqueous extract of Cardiospermum halicacabum. AgNPs were confirmed by UV-Visible spectrophotometer analysis showed SPR at 424 nm. FT-IR analysis revealed biomolecules capping of the AgNPs. XRD pattern of synthesized AgNPs was found in face-centered-cubic crystal structure and average crystal size was 23 nm. SEM analyses of the synthesized AgNPs determine the spherical shape and EDX spectra confirmed the presence of silver ions. DLS studies revealed that the synthesized AgNPs showed the average size as 74 nm and Zeta potential value of AgNPs was -34 mv. The C. halicacabum leaf extract synthesized AgNPs efficiency were tested against different bacterial pathogens MTCC-426 Proteus vulgaris, MTCC-2453 Pseudomonas aeruginosa, MTCC-96 Staphylococcus aureus, MTCC-441 Bacillus subtilis and MTCC-735 Salmonella paratyphi, and fungal pathogens Alternaria solani and Fusarium-oxysporum. The antioxidant ability of the AgNPs was tested and the results showed significant DPPH, hydroxyl and superoxide, radical scavenging activities.

5 illus, 4 tables, 44 ref

000279   Sun Z;Zhang L;Fang Y;Huang H;Wang M (Emergency Dep of The First Affliated Hospital of Zhejiang Chinese Med, Hangzhou City, Zhejiang Province, 310018 China) : Study on enzymatic extraction of polyphenol constituents in Fructus choerospondiatis. Biomed Res 2015, 26(2), 321-7.

The objective of the paper is to achieve full utilization of Fructus Choerospondiatis resources, and optimize the extraction process of polyphenols, the active constituents in Fructus Choerospondiatis. Extraction was performed by enzymatic method with total polyphenol content as the investigation indicator, process conditions were optimized using orthogonal design, and the content of gallic acid after enzymatic extraction was determined by HPLC. As results, optimal extraction process of total polyphenols was as follows: extraction time of 2 h, temperature of 65°C, enzyme dosage of 1.5%, pH of 6.0, liquid-solid ratio of 45, and total polyphenol extraction rate of 9.923%. In conclusion, the method presented is simple and feasible, which is superior to conventional solvent extraction methods, and thus can be used as the extraction process of total polyphenols in Fructus Choerospondiatis.

6 illus, 4 tables, 15 ref

000278   Srivastava G;Srivastava P (School of Biochemical Engineering, Indian Institute of Technology, Banaras Hindu Univ, Varanasi, Uttar Pradesh) : Biotechnology approach towards establishment of efficient production alternative for root-derived phytomolecules with optimized yield enhancement parameters from Agrobacterium mediated "hairy root" cultures of Picrorhiza kurroa Royle ex Benth. J med Pl Stud 2016, 4(6), 30-7.

The plant Picrorhiza kurroa Royle ex. Benth is a fast depleting medicinal value plant. This plant yields a crystalline product called ''kutkin,'' in its root, which is usually a mixture of two major C9-iridoid glycosides, i.e., picroside-I (6-Otrans-cinnamoyl catalpol) and kutkoside (10-O-vaniloylcatalpol). The increasing market demand of this phytoconstituent has led to threat of extinction of such a valuable endangered medicinal plant species. Attention has already been focused towards alternatives of developing production of root-derived phytomolecules in order to meet the growing demand of pharmaceutical industries. The role of Agrobacterium rhizogenes mediated ''hairy root'' cultures as an efficient production alternative has undeniably proved its effectiveness in the worldwide arena. This article explores and review current technologies available to develop an optimized in vitro regeneration protocol for large-scale multiplication and Agrobacterium-mediated transformation for induction and establishment of hairy roots of this valuable Indian Himalayan region plant. This plant is consisting of a wide variety of active ingredients and also utilized for establishment and selection of superior individual hairy root clones to enhance the production of root derived phytochemicals from genetically stable Agrobacterium mediated hairy root cultures. The outcome of the present report will elucidate approaches for successful induction, growth, maintenance and selection of the rapidly growing hairy root line of P. kurroa with in vitro production of desired phytomolecule production potential. The present report reviews the superiority of the selected hairy root clone in terms of root biomass and kutkoside/picroside yield over the reported field-grown P. kurroa plant will undoubtedly highlight the significance of the biotechnological approach to be applied, which can endow us with a better substitute for the exploitation of this commercially important, medicinal plant species. Due to endangered status of plants it is urgently required to save this medicinal wealth from extinction and exploit different conservational strategies for its better utilization.

92 ref

000277   Srihardyastutie A;Soeatmadji D W;Fatchiyah (Biology Doctoral Program, Faculty of Science, Brawijaya Univ, Brawijaya) : Relation of elevated serum lipase to Indonesian type 2 diabetes mellitus progression. Biomed Res 2015, 26(2), 293-8.

The increasing level of serum pancreatic enzyme indicates an inflammation of exocrine pancreas, known as pancreatitis. One of the pancreatic enzymes that evaluated in pancreatitis is lipase. The aim of the study was to evaluate the correlation of increasing level of serum lipase with duration of disease and progression of diabetes in Indonesian T2D subject. Subjects were categorized according to ADA 2013 into three groups: healthy controls (n=21), prediabetes (n=12), and diabetes (n=34). The data were analyzed statistically and expressed as mean ± SD. Multivariate analysis of variance was used for showing the differences of the variables. Multiple regressions were applied for correlation studies of the variables and it was continued with Structure Equation Modelling-Generalized Structure Component Analysis (SEM-GCSA) for evaluating the coefficient contribution of each variable in Hypothetic Model. The results showed there were elevated levels of blood glucose, insulin resistance, creatinine, and serum lipase activity in T2D. The increased serum lipase activities were positively correlated with duration of diseases, plasma glucose, HbA1c level, Insulin Resistance Index, and creatinine level, but did not correlate with lipid profile (Cholesterol, Triglyceride, HDL and LDL), and insulin level in Indonesian T2D Patients. Hypothetic structural model showed that decreasing level of insulin contributed to increase insulin resistance, likewise, insulin resistance contributed positively to glucose level, and glucose level contributed to increase HbA1c level and also lipase activity, but the increasing activity of lipase was not contributed significantly to increase glucose level. So, the high serum lipase has correlation with progression of T2D.

3 illus, 2 tables, 31 ref

000276   Solanki H K;Ahmed F;Gupta S K;Nogkynrih B (Centre for Community Medicine, Old O.T. Block, All India Institute of Medical Sciences, New Delhi) : Road transport in urban India: its implication on health. Indian J community Med 2016, 41(1), 16-22.

2 tables, 46 ref

000275   Sneha M;Meenakshi Sundaram N;Kandaswamy A (Biomedical Engineering Dep, PSG College of Technology, Coimbatore-641 004, Email: nmsundaram75@gmail.com) : Synthesis and characterization of magnetite/hydroxyapatite tubes using natural template for biomedical applications. Bull Mater Sci 2016, 39(2), 509-17.

Inorganic nanotubes have attracted much attention during the last few decades for its potential applications in the field of regenerative medicine and controlled drug delivery. In the present work, we have designed and synthesized magnetite hydroxyapatite micro and nanotubes. The first step is the formation of magnetite (Fe₃O₄) tubes on natural template followed by hydroxyapatite (HAp) bioceramic coated on the Fe₃O₄ tubes. HAp improves the biocompatibility and stability of the prepared tubes. Sintering at 900°C improves the crystalline stability of nanotubes and removes the natural template. X-ray diffraction, N₂ adsorption-desorption studies (BET), thermogravimetric analysis, differential scanning calorimetry, optical micrographs, field emission scanning electron microscope and transmission electron microscope studies were carried out to confirm the structural and morphological analysis of prepared magnetic tubular structure.

11 illus, 1 table, 24 ref

000274   Sladowska K;Handzlik J;Kiec-Kononowicz K; Mazur L (Experimental Hematology Dep, Jagiellonian Univ in Krakow, Gronostajowa 9, Krakow, Email: sladowska.katarzyna@gmail.com) : In vitro cytotoxic activity evaluation of phenytoin derivatives against human leukemia cells. Indian J expl Biol 2016, 54(9), 553-9.

Hydantoin derivatives, including phenytoin (5,5-diphenylhydantoin), have recently gained attention as they possess a variety of important biochemical and pharmacological properties. Nevertheless, available information on anticancer activity of hydantoin derivatives is still scarce. Here, we evaluated possible antileukemic potential of four phenytoin analogs, namely: methyl 2-(2,4-dioxo-5,5-diphenylimidazolidin-3-yl)propanoate (1), methyl 2-(1-(3-bromopropyl)-2,4-dioxo-5,5-diphenylimidazolidin-3-yl)propanoat e (2), 1-(3-bromopropyl)-3-methyl-5,5-diphenylimidazolidine-2,4-dione (3) and 1-(3-bromobutyl)-3-methyl-5,5-diphenylimidazolidine-2,4-dione (4). The experiments were performed on human acute histiocytic lymphoma U937 cells and human promyelocytic leukemia HL-60 cells. The present study was conducted using spectrophotometric 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide (MTT) assay and the electronic Beckman-Coulter method. We observed temporary changes in the leukemia cell viability, volume and count. The effects of the four 5,5-diphenylhydantoin derivatives on U937 and HL-60 cells depended on the agent tested and its concentration, the time intervals after the compound application, and the leukemia cell line used. HL-60 cells were more sensitive than U937 cells to the action of the phenytoin analogs (1-4). The antileukemic activities of the three bromoalkyl diphenylhydantoin derivatives (2, 3, and 4) were stronger than that of the compound 1 [methyl 2-(2,4-dioxo-5,5-diphenylimidazolidin-3-yl) propanoate], with no bromoalkyl substituent. The structural modifications of 5,5-diphenylhydantoin are responsible for such varied antileukemic potential of its four derivatives.

3 illus, 18 ref

000273   Singha B;Mazumder P B;Pandey P (Biotechnology Dep, Assam Univ, Silchar-788 011, Email: pbmazumder65@gmail.com) : Characterization of plant growth promoting rhizobia from root nodule of Crotolaria pallida grown in Assam. Indian J Biotechnol 2016, 15(2), 210-6.

From five different sites of Assam, 22 bacterial strains were isolated from the root nodules of Crotolaria pallida. The isolates were subjected to morphological and physiological characterization, and compared with reference strains Rhizobium leguminoserum MTCC-99, Bradyrhizobium japonicum MTCC-120 and Mesorhizobium thiogangeticum MTCC-7001. Although isolates showed close similarity in their morphological features, they had wide variation in their physiological features. All the 10 selected isolates were found to be potent phosphate solubilizer and the isolate DCP1 showed the highest phosphate solubilization efficiency (PSE; 187%). IAA production was detected in 8 isolates with the highest production (66 μg/mL) by MKCP1. The isolates also showed wide variation in their pH and salt tolerance ability. NifH gene analysis revealed the presence of nifH gene in 6 isolates. The result of PCR-RFLP grouped the isolates into three different 16S rDNA types; 2 isolates were related to B. japonicum MTCC-120, 6 isolates were related to R. leguminoserum MTCC-99 and 2 isolates were related to M. thiogangeticum MTCC-7001.

3 illus, 2 tables, 24 ref

000272   Singh S V;et al. (Laboratory of Microbiology, Animal Health Div, Central Institute for Research on Goats, Makhdoom PO-Farah, Mathura-281 122, Email: shoorvir.singh@gmail.com ) : Evaluation of new 'indigenous milk dot-ELISA' as field test' vis-a-vis milk plate-ELISA for the detection of Mycobacterium avium sub species paratuberculosis infection in lactating domestic livestock. Indian J Biotechnol 2016, 15(2), 166-71.

Mycobacterium avium subspecies paratuberculosis (MAP), the cause of incurable Johne's disease (JD), is endemic in both domestic livestock and human population of the country. It is the major cause of low per animal productivity and reduced productive life in domestic livestock, wherein buffaloes, goats and sheep go for early slaughter for harvesting meat and cows are left to roam on the roads of cities and towns. In the present study, milk dot-ELISA test was standardized in efforts to develop a 'field test' for the detection of MAP infection in lactating animals using milk samples. Results of newly developed 'milk dot-ELISA' were compared with well standardized 'indigenous milk plate-ELISA kit', with known sensitivity and specificity. Of the 276 milk samples screened, 43 (32.0%) and 51 (35.9%) were positive in plate-ELISA and dot-ELISA (True Positives), for bovine and caprine paratuberculosis, respectively. Sensitivity and specificity of dot-ELISA vis-a-vis plate-ELISA was 86.2 and 73.8%, respectively. Newly standardized dot-ELISA was found to be highly sensitive, cost effective, quick, repeatable and efficient 'field test' for the screening of milk samples of lactating cattle, buffaloes, sheep and goats against MAP infection.

3 tables, 20 ref

000271   Simon L;Nanthakumar R;Arumugasamy K (PG and Research, Botany Dep, Kongunadu Arts and Science College, Coimbatore, Tamil Nadu) : Phytochemical analysis and antimicrobial activity of Tiliacora acuminata (Lam.) F. Thoms. (Menispermaceae). J med Pl Stud 2016, 4(6), 118-22.

The present study deals with the phytochemical examination and antimicrobial investigation of Tiliacora acuminata (Lam) f. Thoms., an important medicinal plant. The characterizations of compounds present in it were also analyzed using HPLC technique. Qualitative phytochemical analysis of the methanol, ethanol, petroleum ether and aqueous extracts prepared from T. acuminata leaf revealed the presence of alkaloids, flavonoids, terpenoids, cardiac glycosides, phenols, saponins and tannins. The High- performance liquid chromatography analysis also confirmed the occurrence of an alkaloid compound, colocynthin in the methanolic leaf extract. The antimicrobial activity was evaluated using methanolic leaf extracts of the plant. The extract was taken in different concentrations. The analysis was done by disc diffusion method, using 3 bacterial and 3 fungal strains. The bacterial strains used for this study were Serratia spp., Bacillus subtilis and Pseudomonas aeruginosa and the fungal strains were Actinomycetes spp., Candida albicans and Aspergillus niger. The results showed a maximum inhibitory action against all the bacterial and fungal strains with zones of inhibition ranging from 4mm to 17mm. Thus, the study reflects the potential of T. acuminata against the microbes. This observation becomes important in the context of the therapeutical and drug applications of T. acuminata.

1 illus, 3 tables, 18 ref

000270   Shukla M;Agarwal M;Singh J V;Tripathi A K; Srivastava A K;Singh V K (NO, , 96 HA Vihar, Panigaon, Indira Nagar, Lucknow-226 016, Email: drmukeshshukla@gmail.com) : Nonadherence to antiretriviral therapy among people living with HIV/AIDS attending two tertiary care hospitals in district of Northern India. Indian J community Med 2016, 41(1), 55-61.

Adherence to antiretroviral therapy is a principal predictor for the success of human immunodeficiency virus (HIV) treatment. It remains as a challenge to acquired immunodeficiency syndrome (AIDS) treatment and care with the widespread of the associated risks. Therefore, study aims to assess nonadherence level and factors associated with nonadherence to ART among people living with HIV/AIDS (PLHA). A hospital-based, cross-sectional study was conducted at two tertiary care hospital of Lucknow. A total of 322 adult HIV-positive patients registered in the ART center were included. Systematic random sampling was used to recruit patients. Nonadherence was assessed on the basis of pill count method. A total of 10.9% of patients were found to be nonadherent to ART. Principal causes cited were being busy with other work (40.0%), felt sick or ill (28.5%), not having money (14.2%), and being away from home (11.4). Multivariate logistic regression analysis revealed that nonadherence was significantly associated with nonbeneficial perceptions towards ART (odds ratio (OR) 18.5; 95% confidence interval (CI) 3.2-106.6; P = 0.001), being counseled for adherence for more than 3 months (OR 13.9; 95% CI 1.6-118.9; P = 0.01), presence of depression (OR 2.6; 95% CI 1.0-6.7; P = 0.04), and those who were not satisfied with healthcare facilities (OR 5.63; 95% CI 1.88-16.84; P = 0.00). Although adherence to ART varies between individuals and over time, the factors that affect nonadherence can be addressed with proper periodic counseling and motivation of patients and their family members. Adherence to highly active antiretroviral therapy (HAART) could delay the progression of this lethal disease and minimize the risk of developing drug resistance.

4 tables, 21 ref

000269   Sherin L;Mustafa M;Shujaat S (Chemical Engineering Dep, COMSATS Institute of Information Technology, Defence Road, Off Raiwind Road, Lahore, Pakistan, Email: lubnasherin@ciitlahore.edu.pk) : Evaluation of Terminalia bellerica Roxb. leaf extracted in different solvents for antioxidant activity. Asian J Chem 2015, 27(12), 4527-31.

Terminalia bellerica, an esteemed ayurvedic plant, is employed traditionally in the management of an array of diverse pathological conditions. The present work is aimed to assess antioxidant potential of plant leaf extracts. Crude methanol extract was fractioned with different solvents and antioxidant activities along with total phenolic and flavonoid content were investigated with different antioxidant testing models, including DPPH, ABTS, anti-lipid peroxidation and total antioxidant capacity assays. Ethyl acetate (IC₅₀ = 3.48 μg mL^-1) as well as chloroform (IC₅₀ = 4.55 μg mL^-1) extracts exhibited persuasive DPPH radical scavenging activity, much better than standard antioxidant Trolox (IC₅₀ = 6.17 μg mL^-1). In ABTS assay, ethyl acetate extract (IC₅₀ = 0.18 μg mL^-1) showed enhanced potential in comparison to other extracts and standard antioxidants Trolox and n-propyl gallate. Chloroform extract offered maximum protection against lipid peroxidation (IC₅₀ = 0.28 mg mL^-1) and highest total antioxidant activity (4.54 mM g^-1). All the extracts showed variable magnitude of phenolics and flavonoids content. In conclusion, ethylacetate and chloroform extracts of Terminalia bellerica leaf possess potent antioxidant potential which could be harnessed as economically viable source of natural antioxidants.

3 illus, 2 tables, 26 ref

000268   Shamim M Z;Manzar H;Sharma V K;Kumar P (Agricultural Biotechnology and Molecular Biology Dep, Rajendra Agricultural Univ, Pusa-848 125, Email: mzshamim85@gmail.com) : Microsatellite marker based characterization and divergence analysis among rice varieties. Indian J Biotechnol 2016, 15(2), 182-9.

The simple sequence repeat (SSR) marker analysis was carried out to determine the diversity among 18 rice varieties grown in Bihar. In total, 223 alleles were detected at the 30 SSR loci, of which all were polymorphic. The number of alleles generated by each marker ranged from 3 to 12 with an average 7.43 alleles per locus. The size of alleles ranged from 66 (RM 161) to 607 bp (RM 128). Polymorphism information content (PIC) values ranged 0.059 (RM 161) to 0.929 (RM 429) with an average of 0.665 per marker. A dendrogram based on SSR polymorphism grouped all the 18 rice varieties into three major clusters, effectively differentiating the long, medium and short period of maturity varieties, except Richharia that has short maturity period but placed with medium maturity period varieties. It could be concluded that SSR markers are powerful tools to assess the genetic diversity of the varieties. The knowledge about genetic diversity will be helpful to select parental plant for hybridization according to the changing climate.

2 illus, 1 table, 29 ref

000267   Satapathy S;Swain R;Pandey V;Behera C (Psychiatry Dep, All India Institute of Medical Sciences (AIIMS), New Delhi-110 029, Email: dr.sujatasatapathy@gmail.com) : An adolescent with bestiality behaviour: psychological evaluation and community health concerns. Indian J community Med 2016, 41(1), 23-6.

Bestiality is a serious but less commonly reported form of animal cruelty occurring in a society. It is a punishable sexual offence in India. Bestiality has received little attention in recent psychiatric literature, and even though case reports have been published, an elaborate psychological assessment is often missing. This case report of 18 year old male presented here highlighted the importance of psychological assessment to emphasize on its implications for the further risk assessment of the person, family psycho-education and non-pharmacological intervention for bestialists. The overall assessment suggested of absence of any brain dysfunction and active psychopathology, average intelligence (IQ) and intact cognitive functioning. The findings portrayed physical and sexual inadequacies, emotional and sexual immaturity, difficulty in emotional attachment, internalized hostility, voyeuristic tendencies and infantile social behaviour, excitement seeker, inability to delay gratification of impulses, lacks empathy, poor self-discipline, less conscientiousness and less sensitive to criticism. The report also emphasized the role of child sexual abuse on sexual behavior later life. The importance of including the topic within the community health/sexual and reproductive health education programmes was highlighted.

2 illus, 12 ref

000266   Satapathy R;Jadhav R S;Swamy P L (Biochemistry Dep, Gulbarga Univ, Gulbarga, Karnataka, Email: paramjyothi.swamy99@gmail.com) : Antioxidant activity of Wattakaka valubilis (Linn.f.) leaf extract in carbon tetrachloride induced mice. Indian J expl Biol 2016, 54(7), 467-71.

Plants are natural source of antioxidants which ameliorate a variety of diseases. In this study, we determined the in vitro and in vivo antioxidant activity of methanolic, polyphenolic and sapogenin mixture leaf extracts of Wattakaka volubilis (Linn.f.) Stapf, an ayurvedic medicinal plant. The in vitro antioxidant activity was tested spectrophotometrically by measuring ferric reducing power, DPPH and hydroxyl radical scavenging activity. Whereas the in vivo antioxidant activity was determined by estimation of enzymes catalase, superoxide dismutase (SOD), peroxidase and lipid peroxidation. In vitro study results showed that the tested extracts were capable of reducing ferric ion and scavenging free radical as well as hydroxyl radical. Treatment of mice with single dose of CCl₄ resulted in decreased level of catalase, superoxide dismutase (SOD) and peroxidase, but with 3-fold increase in lipid peroxidation. However, pretreatment of mice with methanolic and polyphenolic sample extracts caused prevention of catalase, and peroxidase when compared with control, where as lipid peroxidation was brought back to normal. NOS activity was also found significantly decreased.

1 illus, 1 table, 32 ref

000265   Saritha M;Tiwari R;Singh S;Nain P K S;Rana S; Adak A;Arora A;Nain L (Microbiology Div, Indian Agricultural Research Institute (Pusa campus), New Delhi-110 012, Email: latarajat@yahoo.co.in) : Glycoside hydrolase production by Aspergillus terreus CM20 using mixture design approach for enhanced enzymatic saccharification of alkali pretreated paddy straw. Indian J expl Biol 2016, 54(8), 518-24.

A successful lignocellulosic ethanol production process needs to address the technological impediments such as cost-competitiveness and sustainability of the process. Effective biomass utilization requires a repertoire of enzymes including various accessory enzymes. Developing an enzyme preparation with defined hydrolytic activities can circumvent the need for supplementing cellulases with accessory enzymes for enhanced hydrolysis. With this objective, mixture design approach was used in the present study to enhance glycoside hydrolase production of a fungal isolate, Aspergillus terreus CM20, by determining the proportion of different lignocellulosic components as enzyme inducers in the culture medium. A mixture of paddy straw and wheat straw (1.42:1.58) resulted in improved cellulolytic activities. The precipitated crude enzyme showed higher CMCase (365.03 18 IU g^-1), FPase (161.48 IU g^-1), avicelase (15.46 IU g^-1), β-glucosidase (920.92 IU g^-1) and xylanase (9627.79 IU g^-1) activities. The potential of the crude enzyme for saccharification of alkali pretreated paddy straw was also tested. Under optimum conditions, saccharification released 25.0 g L^-1 of fermentable sugars. This indicates the superiority of the crude enzyme produced with respect to its hydrolytic enzyme components.

2 illus, 2 tables, 37 ref

000264   Saraswathi M S;Kannan G;Uma S;Thangavelu R; Backiyarani S (Crop Improvement, ICAR-National Research Centre for Banana, Tiruchirappalli-620 102, Email: saraswathimse@gmail.com) : Improvement of banana cv. rasthali (Silk, AAB) against Fusarium oxysporum f.sp. cubense (VCG 0124/5) through induced mutagenesis: determination of LD₅₀ specific to mutagen, explants, toxins and in vitro and in vivo screening for fusarium wilt resistance. Indian J expl Biol 2016, 54(5), 345-53.

Shoot tips and in vitro grown proliferating buds of banana cv. Rasthali (Silk, AAB) were treated with various concentrations and durations of chemical mutagens viz., EMS, NaN₃ and DES. LD₅₀ for shoot tips based on 50% reduction in fresh weight was determined as 2% for 3 h, 0.02% for 5 h and 0.15%for 5 h, while for proliferating buds, they were 0.6% for 30 min, 0.01% for 2 h and 0.06% for 2 h for the mutagens EMS, NaN₃ and DES, respectively. Subsequently, the mutated explants were screened in vitro against fusarium wilt using selection agents like fusaric acid and culture filtrate. LD₅₀ for in vitro selection agents calculated based on 50% survival of explants was 0.050 mM and 7% for fusaric acid and culture filtrate, respectively and beyond which a rapid decline in growth was observed. This was followed by pot screening which led to the identification of three putative resistant mutants with an internal disease score of 1 (corm completely clean, no vascular discolouration). The putative mutants identified in the present study have also been mass multiplied in vitro.

4 illus, 3 tables, 45 ref

000263   Sandeep Kumar;Prasad S;Malav M K;Gupta N (Centre for Environment Sci. & Climate Resilient Agriculture, Indian Agricultural Res. Instt., New Delhi-110 012, Email: sandeep2011iari@gmail.com) : Characterizatio and pretreatment of wheat straw using microwave assisted dilute acit to produce fermentable sugars for hydrogen production. Green Fmg 2016, 7(1), 95-8.

Among the agricultural crop residues, wheat straw is the second largest biomass feedstock in the world after rice straw. The recent study was done to evaluate fermentable sugars production potential of wheat varieties, mostly grown in northern and central a part of India, which has not been studied before with respect to hydrogen production. Characterization of wheat varieties on the basis of its chemical constituents i.e. fibre (cellulose, hemicellulose and lignin), sugar content and total solids, showed it as a potential feedstock for hydrogen production. Pretreatment is considered the most important step in determining the cost and success of the process of enzymatic saccharification of lignocellulosic biomass. The effectiveness of pretreatment using microwave assisted dilute acid to produce maximum fermentable sugars in terms of total soluble sugar from the straw was investigated. The results showed that microwave assisted acid pretreatment is a promising approach to enhance total soluble sugar yields for hydrogen production. The temperature 160°C and time period 10 min was best for total soluble sugar recovery from wheat straw. The wheat variety HD 2967 was found to be the best followed by WR 544, C 306 and K 68 with respect to the release of soluble sugars from the straw. HD 2967 had significantly higher value in terms of sugar than other varieties.

10 tables, 17 ref

000262   Samydurai P;Saradha M;Ramakrishnan R;Santhosh Kumar S;Thangapandian V (Botany Dep, Kongunadu Arts and Science College (Autonomous), Coimbatore-641 029, Email: samydurai.bio@gmail.com) : Micropropagation prospective of cotyledonary explants of Decalepis hamiltonii Wight & Arn.-an endangered edible species. Indian J Biotechnol 2016, 15(2), 256-60.

The study was undertaken to standardize the development of callus, shoot and root regeneration from cotyledonary explant of Decalepis hamiltonii Wight & Arn. through the tissue culture techniques. The MS medium supplemented with 6-benzyl amino purine (BA), 2,4-dichlorophenoxy acetic acid (2,4-D), kinetin (Kn), gibberelic acid (GA₃), indole acetic acid (IAA), indole butyric acid (IBA) and 1-naphthalene acetic acid (NAA) was used for callus, shoot and root regeneration. The maximum percentage (82.0%)of callus formation was achieved on 0.5 mg/L BA in combination with 0.05 mg/L Kn, followed by 78.5% of callus formation on 0.5 mg/L 2,4-D fortified with 0.05 mg/L Kn. The highest shoot proliferation (4.6 shoots/callus) and shoot length (6.9 cm) was achieved on 1.0 mg/L BA combined with 0.1 mg/L GA₃, followed by 3.8 shoots per callus and 5.8 cm shoot length on 1.0 mg/L IAA combined with 0.1 mg/L GA₃. The highest root formation (38.2 roots/shoot) and root length (11.8cm) was achieved on 1/2 strength MS medium fortified with 0.4 mg/L IBA, followed by 36.5 roots per shoot and root length of 10.7 cm on 0.4 mg/L NAA. The well-developed rooted plantlets were hardened in the mixtures of forest soil, soil and vermiculite (1:1:1) and 97.5% plantlets survived after hardening.

1 illus, 4 tables, 26 ref

000261   Sahu A K;Nehra C;Mishra R;Verma R;Gaur R K (Biosciences Dep, College of Arts, Science and Humanities, Mod Univ of Science and Technology, Lakshmangarh, Sikar-332 311, Email: gaurrajarshi@hotmail.com) : Molecular evidence of chili vein mottle virus and chilli leaf curl virus simultaneously from naturally infected chilli plants (Capsicum annuum L.). Indian J Biotechnol 2016, 15(2), 266-8.

The occurrence of Chilli leaf curl virus (ChLCV) and Chilli vein mottle virus (CVMV) were detected by using the duplex PCR in the mixed infected Chilli plants (Capsicum annuum L.). The duplex PCR was done by using the specific primer Pot 1 and Pot 2 for CVMV and AVF28 and AV29R for ChLCV. The amplicon and the sequence analysis confirmed the presence of potyvirus and begomovirus in the mixed infection. This combinations exhibited synergistic symptoms and large numbers of cells were doubly infected. This paper reports highly specific conventional PCR assays for detection of two independent viruses infecting chilli plants simultaneously.

^ssc2 illus, 1 table, 10 ref

000260   Rekadwad B;Pathak A (School of Life Sciences, Swami Ramanand Teerth Marathwada Univ, Nanded-431 603, Email: bnrekadwad@gmail.com) : First report on revelatory prokaryotic diversity of unkeshwar hot spring (India) having biotechnological potential. Indian J Biotechnol 2016, 15(2), 195-200.

Morphologically distinct strains of thermophilic bacteria (17 in number) isolated at 70oC from a hot spring in Unkeshwar (19° 85' N and 78° 25' E), Nanded district, Maharashtra state, India. All isolates have been characterized and identified using phenotypic and genotypic characters. Facultative bacterial growth was observed within 12-16 h of incubation at 70°C. The bacterial strains could tolerate temperature between 45-90°C (optimum 45-65°C) and pH between 5-9 (optimum 7-8). Based on morphological characteristics, biochemical tests and 16S rRNA gene sequence analyses, isolates belonged to Firmicute, Proteobacteria and Actinobacteria. This is the first report of microbial diversity associated with Unkeshwar hot spring in Nanded based on wet laboratory results. Our results revealed the presence of different thermophilic and thermoduric industrially important bacteria in Unkeshwar hot spring.Some of these isolates showed resistance to antibiotics, such as, (Bacitracin, 10 units/disc; Ciprofloxacin HCl, 5 mcg/disc; Polymyxin B, 300 mcg/disc & Tetracycline, 30 mcg/disc). All reported isolates had produced products stable at high temperatures, such as, amylase, gelatinase, protease, urease, oxidase and antibiotics having various applications in starch, food, feed, pulp and paper, detergents, leather processing, healthcare-especially dental and skin, and pharmaceutical industries.

6 illus, 1 table, 8 ref

000259   Razavipour S T;Behnammorshedi M;Razavipour R; Ajdary M (Biology Dep, Payame Noor Univ, I.R. of Iran) : Effect of nickel nanoparticles on oxidative stress and inflammatory markers. Biomed Res 2015, 26(2), 370-4.

Due to extensive application of nanoparticle in industries and medicine, their advantages and disadvantages have been paid attention to. In addition to useful applications, nanoparticles have different effects on body tissue. This study conducted to explore the toxic effect of nickel oxide nanoparticles on oxidative stress system and its damaging effect on the immune system of the rats. In this experimental study, 40 male Wistar rats were randomly divided into two groups. The experimental group received nickel oxide nanoparticles in the form of mixture with water in 25ppm dose for seven consecutive days. The control group received drinking water and food. After 7 days, the serum levels of INF-γ, IL-4, MDA, CAT and GPX were measured and the data were analyzed using Independent t-test and SPSS-15 software. Interleukin-4 and interferon-? were significantly increased in the experimental group (25ppm) (P<60>0.05). MDA was also significantly increased in the experimental group compared with the control group (P<60>0.05). GPX and CAT were significantly reduced in the experimental group compared with the control group (P<60>0.05). Nanoparticles of nickel oxide resulted in the creation of free radicals and increased oxidative stress and inflammation in rats.

3 illus, 22 ref

000258   Raza Z A;Ahmad N;Khalid Z M;Ahmad N (Chemistry Research Laboratory, National Textile Univ, Faisalabad 37610, Pakistan) : Response surface optimization in biosurfactant production by using a renewable growth substrate. Indian J Biotechnol 2016, 15(2), 217-29.

The present study investigated the use of blackstrap molasses as renewable carbon source by a Pseudomonas aeruginosa strain to produce rhamnolipid surfactant under shake flask conditions. The process factors considered were total sugar concentration, carbon to nitrogen ratio and incubation period, whereas the responses were utilized total sugar, dry cell biomass, rhamnolipid yield, surface tension and certain kinetic parameters. This is the first report on response surface optimization in biosurfactant production by P. aeruginosa strain grown on molasses. Statistical modeling for all the considered responses was done through desirability, which expressed that the percentage of prediction error was much low. This explains that the prediction performance of the models is quite adequate. The highest dry cell biomass (1.63 g/L) and rhamnolipid (1.46 g/L) yields were observed at 5 d of incubation on 2% total sugars-based molasses amended with sodium nitrate (at C:N, 20:1). The surface tension of this culture medium dropped to 28.0 from 50.0 mN/m.

7 illus, 7 tables, 17 ref

000257   Ramswamy S V P;Narendhran S;Sivaraj R (Biotechnology Dep, Environmental Nanobiotechnology Laboratory, School of Life Sciences, Karpagam Univ, Coimbatore-641 021, Email: rammpriya@gmail.com) : Potentiating effect ecofriendly synthesis of copper oxide nanoparticles using brown alga: antimicrobial and anticancer activities. Bull Mater Sci 2016, 39(2), 361-4.

This study reports the in vitro antimicrobial and anticancer activities of biologically synthesized copper nanoparticles. The antimicrobial activity of green synthesized copper oxide nanoparticles was assessed by well diffusion method. The anticancer activity of brown algae-mediated copper oxide nanoparticles was determined by MTT assay against the cell line (MCF-7). Maximum activity was observed with Pseudomonas aeruginosa and Aspergillus niger. Effective growth inhibition of cells was observed to be more than 93% in antibacterial activity. Thus, the results of the present study indicates that biologically synthesized copper nanoparticles can be used for several diseases, however, it necessitates clinical studies to ascertain their potential as antimicrobial and anticancer agents.

3 illus, 23 ref

000256   Rahat A;Bashir S;Khattak K F;Ahmad B;Khan I; Azam S;Ali J;Ahmad J (College of Home Economics, Peshawar Univ, Peshawar, Pakistan, Email: saadb23@yahoo.com) : Antifungal, antibacterial, phytotoxic and insecticidal activities of Nigella sativa seeds. Asian J Chem 2015, 27(12), 4591-4.

The crude methanolic extract and different fractions (n-hexane, chloroform, ethyl acetate) of Nigella sativa seeds were screened for antifungal, antibacterial, phytotoxic and insecticidal activities. The methanolic extract showed total inhibitions against Escherichia coli, Proteus mirabilis, Bacillus cereus and Xanthomonas oryzae at 3 mg/mL. The n-hexane fraction showed significant antibacterial activity against P. mirabilis, B. cereus and X. oryzae, while CHCl₃ fraction had 100% inhibition against P. mirabilis, X. oryzae and E. coli. Chloroform fraction possessed significant antifungal activity against Penicillium oxalicum, Acremonium strictum, Verticillium lecanii and Trichoderma harzianum. The methanolic extract exhibited significant activity (92%) against P. oxalicum, good activity (64%) against A. strictum and moderate activity (56%, 42%) against V. lecanii and T. harizinum respectively. The n-hexane, aqueous and EtOAc fractions were also found active against most of the test fungi. The methanolic extract showed good (75%) phytotoxic activity against Lemna minor, while EtOAc and n-hexane fractions showed no phytotoxicity. Chloroform fraction showed 70% mortality of Tribolium castaneum, while EtOAc and n-hexane fractions showed no activity against T. castaneum.

4 illus, 24 ref

000255   Rafsanjani M S O;Kiran U;Ali A;Abdin M Z (Centre for Transgenic Plant Development, Biotechnology Dep, Faculty of Science, Jamia Hamdard, Hamdard Nagar, New Delhi-110 062, Email: mzabdin@rediffmail.com) : Transformation efficiency of calcium phosphate nanoparticles for genetic manipulation of Cichorium intybus L.. Indian J Biotechnol 2016, 15(2), 145-52.

The production of transgenic plants is a valuable tool in plant research and this technology is extensively applied in phytomedicines and agricultural sciences. Encapsulation of gene into biocompatible carriers enhances the biotransformation process and related outcomes by providing protection to the cell, gene and enzymes. The efficacy of calcium phosphate (CaP) nanoparticles with respect to Agrobacterium tumefaciens for genetic manipulation of Cichorium intybus L. plants, using pBinAR containing trans-hmgr gene, was observed in the present study. The CaP nanoparticle-based genetic transformation resulted in the transformation frequency of 9.6%. The transgenic plants were also found to accumulate higher levels of chlorophyll, soluble protein and esculin contents when compared with non-transformed C. intybus plants, which could be due to higher expression of the hmgr transgene and the higher activity of the HMGR enzyme. The CaP nanoparticle gene delivery system based on ultra-size inorganic nanoparticles showed great potential to mediate gene transfer into plants. These particles being nonspecific and smaller in size can deliver gene(s) into dicots, monocots and sub-cellular organelles of the plant cells. Therefore, they could be used in genetic engineering of crops to develop new improved varieties having higher yields and pharmacrops to produce therapeutic molecules including vaccines.

2 illus 2 tables, 43 ref

000254   Priya C;Ganessin A;Thilagaraj W R (Biotechnology Dep, School of Bioengineering, SRM Univ, Chennai-603 203, Email: thilagaraj.richard@gmail.com) : Efficiency of surface modified Ti coated with copper nanoparticles to control marine bacterial adhesion under laboratory simulated conditions. Bull Mater Sci 2016, 39(2), 345-51.

Titanium (Ti) used as condenser material in nuclear power plants encounter severe biofouling in marine environment which in turn affects the efficiency of the metal. To reduce the biofouling by marine microorganisms, surface modification of the Ti was carried out by anodization process to obtain nanotubes (TiO₂-NTs). The electrolyte solution containing 1% of ammonium fluoride resulted in uniform growth of TiO₂-NTs. TiO₂-NTs were further coated with chemically synthesized copper nanoparticles (NT-CuNP) using 3-amino propyl triethoxy silane as a coupling agent. NT-CuNP was characterized by field-emission scanning electron microscopy (FE-SEM), energy-dispersive spectroscopy and X-ray diffraction. The stability of the coating was determined by the amount of Cu+ ions released into the surrounding using AAS. The microbial adhesion on the surface of Ti, TiO₂-NTs and NT-CuNP coupons were evaluated by sea water exposure studies using total viable count method and also characterized by FE-SEM for any morphological changes. The NT-CuNP coupons show a 60% reduction in microbial adhesion when compared to control Ti coupons.

8 illus, 33 ref

000253   Poy S P;Kannadasan T;Gupta R (Pharmacology Dep, Shree Dhanvantary Pharmacy College, Kim, Surat, Gujarat) : Screening of hepatoprotective activity of Madhuca longifolia bark on D-galactosamine induced hepatotoxicity in rats. Biomed Res 2015, 26(2), 365-9.

In this present investigation the ethanolic extract of Madhuca longifolia bark (EEMLB) was screened for hepatoprotective activity against D-galactosamine (d-GalN) induced hepatiotoxicity in rats. Wistar rats were divided into five groups (n=6). Hepatotoxicity in rats was achieved by intraperitoneal injection of 400mg/kg of d-GalN for five days. Silymarin (100mg/kg) was given as reference standard. The degree of protection against liver toxicity was determined by measuring the serum biochemical parameters viz. SGPT (serum alkaline phosphatase), SGOT (serum glutamine oxaloacetate transaminase), ALP (alkaline phosphatase), total cholesterol and bilirubin (Total and Direct). The result shows that d-GalN has enhanced the levels of SGPT, SGOT, ALP, total cholesterol and bilirubin. Pretreatment with EEMLB (200mg/kg B. wt. and 400 mg/kg B. wt.) brought back the altered levels of biochemical markers to the near normal levels. Histopathological studies also confirmed the hepatoprotective activity of these extracts when compared with d-GalN treated groups. It can be concluded from the result that the extract of Madhuca longifolia bark possesses hepatoprotective activity against D-GalN induced hepatotoxicity in rats.

5 illus, 1 table, 28 ref

000252   Paudel B P;Jayasree Sankar S (Soil Science & Agricultural Chemistry Dep, College of Horticulture, Vellanikkara, Kerala Agricultural Univ, Thrissur-680 656) : Efficacy of Azolla as a co-substrate of cow dung for manurial enrichment of biogas slurry. Green Fmg 2016, 7(1), 50-6.

The present research work was conducted to study the suitability and potential of azolla (Azolla pinnata) in augmentation biogas and slurry in the Deptt. of Soil Sci. & Agric. Chemistry, College of Horticulture, KAU, Thrissur, during the period 2010-2012. Co-digestion of cow dung and azolla (Azollapinnata) in the ratio 1:0.5 in floating drum plants of 0.5 m3 capacity produced maximum volume of biogas (0.29 m3 kg^-1 TS) as against 0.21 m3 kg^-1 TS obtained from cow dung alone treatment in 26 days, recording an increase of 27.58%. The Hydraulic retention time, an indication of completion of digestion, could be reduced by six days upon using azolla as co-substrate. Mixing azolla with cow dung in equal ratio increased the nitrogen content of slurry by 50% than in its absence. Response of rice variety Jyothy to the enriched manure revealed that the grain (44.97 g pot^-1) and straw (72.73 g pot^-1) yield was maximum when the crop was nourished with enriched manure II in association with the recommended dose of chemical fertilizers. Crop uptake of N (4260 mg pot^-1) and K (4263 mg pot^-1) was also the highest in this treatment.

14 tables, 24 ref

000251   Paria A;Dong J;Babu P P S;Makesh M;Chaudhari A;Thirunavukkarasu A R;Purushothaman C S;Rajendran K V (NO, Central Institute of Fisheries Education (CIFE), Versova, Mumbai-400 061, Email: rajendrankv@hotmai.com) : Evaluation of candidate reference genes for quantitative expression studies in Asian seabass (Lates calarifer) during ontogenesis and in tissues of healthy and infected fishes. Indian J expl Biol 2016, 54(9), 597-605.

Quantitative real-time PCR (qRT-PCR), used to determine the gene expression profile, is an important tool in functional genomic research, including fishes. To obtain more robust and meaningful result, the best possible normalization of the data is of utmost significance. In the present study, we have evaluated the potential of five commonly used housekeeping genes i.e., elongation factor 1-α (EF1A), β-Actin (ACTB), 18S ribosomal RNA (18S), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and β-2-Microglobulin (B2M) in normal physiological conditions, developmental stages and in response to bacterial infection in Asian seabass, Lates calcarifer (Bloch), an important food fish cultured in the Asia-Pacific region. The expression levels of these five genes were estimated in 11 tissues of normal seabass juveniles, 14 embryonic and larval developmental stages and six tissues of Vibrio alginolyticus-challenged animals. Further, the expression stability of these genes was calculated based on three algorithms i.e. geNorm, NormFinder and BestKeeper. The results showed that although there are tissue-specific variations for each gene, ACTB and EF1A are the most stable genes across the tissues of normal animals. However, in bacteria-challenged animals, EF1A and 18S were found to be the best reference genes for data normalization. The expression of all the genes tested showed an increasing trend in developmental stages and the increase was significant at blastula stage. Among the five genes tested, EF1A and ACTB were found to be the genes with least variation and highest stability across the developmental stages. This forms the first report on validation of housekeeping genes in L. calcarifer, in the context of ontogenic development and in response to infection.

1 illus, 5 tables, 42 ref

000250   Nurmahanbaevna K Z;Satayev M I;Altynbekov R F;Saipov A A (M.Auezov South Kazakhstan State Univ, , Kazakhstan, Email: rustik2030@inbox.ru) : Production of a highly concntrated methane by the membranous biogas treating, formed at the biomass densification based on agricultural wastes. Biosci Biotechnol Res Asia 2016, 13(1), 43-51.

The membranous biogas treating research allowed determine optimal parameters of the process, affecting the membrane separation efficiency, permeability and selectivity. The working pressure falls within the limits of 0.6 MPa. Themembranousgastreatingregularitiesinamembraneapparatusweredetermined . The concentration-permeability relation and pressure effect on the permeability were determined. A mass transport mechanism through the membrane pores was established. The membrane structure and material basic requirements and membranous process principle at the gas treating were established. Relation of the membrane mass-transfer coefficient to a permeate flow on the phase rate, the mass-transfer coefficient in the membrane pores on an inside diffusion coefficient showed that increase in the rate results in increase of the mass-transfer coefficient, and also that while the external mass-transfer resistance determines the overall process rate, the process can be intensified.

7 illus, 1 table, 47 ref

000249   Ninan G;Zynudheen A A;John A;Binsi P K;Joshy C G (Central Institute of Fisheries Technology (ICAR), , Matsyapuri P.O., Cochin-682 029, Email: george66jiji@gmail.com) : Effect of pretreatment conditions and bleaching on physico-chemical and functional properties of gelatin prepared form cuttlegish skin. Indian J Fish 2015, 62(2), 62-9.

Gelatin was extracted from the skin of cuttlefish Sepia pharaonis after pretreatment with sodium hydroxide (NaOH) and bleaching with hyjdrogen peroxide (H₂O₂) for varying durations. The extracted gelatin was lyophilised and quality characteristics were assessed. There was a significant increase (15.5-17.1%) in the yield of gelatin extracted from skin treated with 5% H₂O₂ for 24 h when compared to control samples. Viscosity of the gelatin samples were in the range of 3.76-6.54 cP which can be considered to be in the mid-range since viscosities for commercial gelatin have been reported to be in the range 2.0-7.0 cP. Bleaching the skin with H₂O₂ significantly improved the bloom strength of extracted gelatin. Maximum bloom strength was obtained for gelatin extracted from skin bleached for 48 h (133-140 g) whereas it was only in the range of 22-28 g for gelatin from unbleached skins. Gelatin from treated skin samples had significantly higher L* values in the range of 90.4-92.8 than control samples indicating superior white colour. Functional properties viz., foaming and fat binding properties were also significantly improved by bleaching. Gelatin extracted from the ventral skin of cuttlefish after bleaching with H₂O₂ exhibited characterestics of Type B gelatin with desirable functional properties suitable for commercial utilisation. The skin of cuttlefish, which is considered to be an environmental hazard as a processing waste has the potential to yield good quality gelatin.

3 illus, 2 tables, 54 ref

000248   Natarajan S K;Gupta D (Textile Technology Dep, Indian Institute of Technology Delhi, New Delhi-110 016, Email: deepti@textile.iitd.ernet.in) : Bio mimetic coloratin of wool using plant juice. Indian J Fibre Text Res 2016, 41(3), 306-11.

The paper reports study on the optimisation of coloration of wool, through in situ reaction of diphenolic catechol with enzymes present in potato juice. Color formation takes place at low temperature and without any use of auxiliary chemicals. Response surface methodology has been used to study the effect of process variables, such as temperature and respective concentrations of catechol and plant juice, on the intensity of color obtained on fabric. A range of shades varying K/S from 2 to 10 is produced. Temperature is found to be the most significant factor affecting the color strength. Colour continues to become deeper with the increase in temperature of treatment. Optimised recipes have been proposed for producing a particular shade on wool. Spectroscopic analysis of coloured wool shows no specific peaks, pointing towards formation of colorants having a non specific molecular structure. Colours obtained on wool are found to be fast to light and washing.

4 illus, 4 tables, 21 ref

000247   Nasir M N;Habsah M;Adzim M K R;Norhayati A H; Muraldhara D V;Zubaidi A L (Faculty of Medicine, Sultan Zainal Abidin Univ, Kuala Terengganu, Malaysia) : Acue effects of triterpene compounds on locomotor performance and Morris water maze task in Spraque-Dawley rats. Biomed Res 2015, 26(2), 304-10.

Centella asiatica has been recognized as one of the plants that can be used to surge cognitive function in animals and humans. Currently, several compounds isolated from C. asiatica have been proven to enhance cognitive function via learning and memory properties. The present study investigated the acute effects of administration of triterpene compounds isolated from C. asiatica on memory and learning in male Spraque-Dawley rats via Morris water maze and their influences on motor activity in locomotor performance. The five-week old Spraque-Dawley rats were intraperitoneally administered with 10 mg/kg concentration of triterpene compounds; asiatic acid, madecassic acid, madecassoside and the control groups with scopolamine and saline. The rats were then evaluated via Morris water maze tasks and locomotor activity. The administration of 10 mg/kg of asiatic acid resulted in significantly improved memory (p<60>0.5) with increased escaped latency compared to saline and scopolamine. Furthermore, the administration of 10 mg/kg of madecassic acid and madecassoside significantly induced higher escape latency compared to scopolamine (p<60>0.5) but there was no significant difference compared to saline (p<60>0.5). For spontaneous locomotor activity, the three triterpene compounds showed no effect on locomotor activity as compared to saline group. However, the triterpene compounds had significant effect on locomotor activity as compared to scopolamine group (p<60>0.5). The administration of acute asiatic acid facilitated escaped latency which can be translated as having the properties of enhancement on memory and learning. Hence, it may serve to be useful on improving memory and learning with no sedative effect on the locomotor performance.

3 illus, 27 ref

000246   Narayani M;Johnson M;Babu A;Malar T R J J; Janakiraman N (Centre for Plant Biotechnology, Botany Dep, St. Xavier's College (Autonomous), Palayamkottai-627 002, Email: ptcjohnson@gmail.com) : Somaclonal variation studies in Orthosiphon stamineus (Benth.) using SDS-PAGE. Indian J Biotechnol 2016, 15(2), 269-71.

The present investigation was intended to reveal somaclonal variation in Orthosiphon stamineus Benth. using SDS-PAGE as a tool. For electrophoretic studies, the proteins were isolated from mother plants, in vitro plantlets raised through nodal segments and plantlets regenerated from the leaf-derived calli of Orthosiphon stamineus, and separated using SDS-PAGE. Mother plants and nodal-segment derived plantlets were confirmed for their genetic uniformity by expressing similar banding pattern in the gel system. The proteins PP1² (0.08), PP2² (0.15), PP3² (0.25) and PP5¹ (0.41) showed their unique presence in plantlets regenerated from leaf derived calli and confirmed the occurrence of somoclonal variants. These protein profiles would be used as a biochemical marker for plant breeding or genetic improvement programme in future to identify mother plants and somaclonal variants of O. stamineus.

2 illus, 1 table, 18 ref

000245   Mukhtar M;Adamu H M;Kolo A M (Science Lab. Tech. Lab, Binyaminu Usman Polytechnic Hadejia, Jigawa State) : Anti-oxidant activity and acute toxicity study of the methanolic root extract of Mitragyna inermis. J Pharmac Phytochem 2016, 5(6), 48-50.

The acetone, methanol and water extracts of Mitragyna inermis were investigated for their antioxidant activity and acute toxicity. The result show strong radical scavenging activity against DPPH for all the three extracts. The LD50 of 1264mg/kg was calculated for methanol extracts and the values was found to be within the practically slightly toxic range and therefore care should taken when using the plants in traditional medicine healing.

1 illus, 1 table, 24 ref

000244   Mukherjee S;Dhananjay Kumar;Chakraborty R (Omics Laboratory, Biotechnology Dep, North Bengal (NBU) Univ, PO NBU, Siliguri-734 013, Email: rcnbu2003@yahoo.com) : Bacterial diversity in sediments of river Mahananda (Siliguri) as determinated by 16S rRNA gene analysis. Indian J Biotechnol 2016, 15(2), 201-9.

Analyses of 16S ribosomal (r) DNA clone library have enabled to assess the bacterial diversity in the sediment of an anthropogenically stressed river Mahananda at Siliguri, India. A total of 178 clones were examined by amplified rDNA restriction analysis (ARDRA) using HaeIII (four base specific restriction enzyme). According to the restriction patterns generated from ARDRA, 71 clones were selected as operational taxonomic units (OTUs) and sequenced. No clones were identical to any of the known 16S rRNA sequences or to each other. Sequencing analysis revealed eight distinct major lineages of bacteria [α, β-, γ-, ω-Proteobacteria, Bacteroidetes, Firmicutes, Chloroflexi & Planctomycetes]. About 69.66% of the sequenced clones were grouped into Proteobacteria [comprising a (12.90%), β (45.96%), γ (2.41%) & ω (38.70%)] and 29.21% were included amongst the divisions other than Proteobacteria represented by Bacteroidetes (34.61%), Firmicutes(57.69%),Chloroflexi (3.84%) and Planctomycetes (3.84%). 16S rRNA gene phylotypes only distantly related to any of the previously identified sequences (non-affiliated rRNA genes) represent a significant fraction of the total cloned sequences. This is the first report describing microbial diversity of Mahananda river sediment by using metagenomic approach. The results suggest that the sediment of river Mahananda is the reservoir of unexplored microbial resources.

2 illus, 29 ref

000243   Mottaghi-Dastjerdi N;Soltany-RezaeeRed M; Sepehrizadeh Z;Roshandel G;Ebrahimifard F;Setayesh N (Pharmaceutical Biotechnology and Pharmaceutial Biotechnology Dep, Research Center School of Pharmacy Tehran Univ of Medical Sciences, Tehran, Iran, Email: nsetayesh@tums.ac.ir) : Gene expression profiling revealed overexpression of vesicle amine transport protein-a (VAT-1) as a potential oncogene in gastric cancer. Indian J Biotechnol 2016, 15(2), 161-5.

Gastric cancer (GC) is one of the most common types of cancer worldwide. Owing to the distinct molecular pathology and the increasing progression rate of GC in Asia, suppression subtractive hybridization (SSH) was used as a high-throughput gene expression analysis method to find genes associated with GC pathogenesis. Total RNA was extracted from the clinical samples, and mRNA was isolated and used in SSH method. The subtracted library was subjected to cloning and the randomly selected clones were sequenced. qRT-PCR was used for expression analysis. The overexpression of vesicle amine transport protein-1 (VAT-1) gene was observed and its expression was analyzed by qRT-PCR in clinical tissue samples. According to the potential oncogenic activity of VAT-1 and its probable surface-occurrence in GC cells, it might be involved in GC pathogenesis and invasion, and it is suggested to be investigated in the diagnosis and therapeutics of GC.

2 illus, 22 ref

000242   Moiseev D (NO, Vitebsk State Medical Univ, Vitebsk, Belarus) : Stress testing of drug substances from herbal origin is a new way of stability investigations of medicinal preparations. J Pharmac Phytochem 2016, 5(6), 21-3.

The article presents data on effect of destructive agents (acid and alkaline hydrolysis, oxidation, exposure of metal ions) on the preservation of flavonoids in the extracts of meadowsweet flowers.

1 illus, 3 tables, 6 ref

000241   Mittal P;Devi R;Gosal S S (School of Agricultural Biotechnology, Punjab Agricultural Univ, Ludhiana-141 004, Email: rumadevi@pau.edu) : Effect of genotypes and activated charcoal on high frequency in vitro plant regeneration in sugarcane. Indian J Biotechnol 2016, 15(2), 261-5.

A series of experiments were conducted to explore the effect of activated charcoal on the in vitro morphogenic response of 3 sugarcane varieties, viz., CoJ 83, CoJ 88 and CoJ 64. The analysis of variance at 5% level of significance indicated that the differences among different varieties and media composition containing different concentrations of activated charcoal were statistically significant. The MS medium supplemented with 2,4-dichlorophenoxyacetic acid (2,4-D; 2.5 mg/L), kinetin (Kin; 0.5 mg/L) and activated charcoal (2.0 g/L) recorded maximum percentage of somatic embryogenesis in CoJ 83 (76.01), followed by CoJ 88 (72.56) and CoJ 64 (64.59). While the best plant regeneration was observed on MS medium supplemented with 6-benzylaminopurine (BAP; 0.5 mg/L) and activated charcoal (2.0 g/L) in CoJ 83 (82.32%), followed by CoJ 88 (73.35%) and CoJ 64 (69.20%). Further, maximum percentage of shoot elongation was observed in CoJ 83, followed by CoJ 88 and CoJ 64, on 1/2 MS medium supplemented with activated charcoal 2.0 g/L. At the same time, it was also noticed that activated charcoal promoted the shoot length in all the varieties and reduced albinism significantly in micropropagated plants. Thus activated charcoal can be added in the plant regeneration media to enhance somatic embryogenesis and plant regeneration. It can efficiently be also used to improve the frequency of shoot multiplication and transformation.

6 illus, 2 tables, 20 ref

000240   Mishra B;Srivastava R;Agarwal J;Srivastava S; Pandey A (Microbiology Dep, King George's Medical Univ, Lucknow, Uttar Pradesh) : Behavioural and psychosocial risk factors associated with first and recurrent cystitis in Indian women: a case-control study. Indian J community Med 2016, 41(1), 27-33.

The risk factors for urinary tract infections (UTIs) from developed countries are not applicable to women from developing world. To analyze the behavioral practices and psychosocial aspects pertinent to women in our region and assess their association with acute first time or recurrent UTI. Sexually active premenopausal women with their first (145) and recurrent (77) cystitis with Escherichia coli as cases and women with no prior history of UTI as healthy controls (257) were enrolled at a tertiary care hospital in India, between June 2011 and February 2013. Questionnaire-based data was collected from each participant through a structured face-to-face interview. Using univariate and multivariate regression models, independent risk factors for the first episode of cystitis when compared with healthy controls were (presented in odds ratios [ORs] with its 95% confidence interval [CI]): Anal sex (OR = 3.68, 95% CI = 1.59-8.52), time interval between last sexual intercourse and current episode of UTI was <60>5 days (OR = 2.27, 95% CI = 1.22-4.23), use of cloth during menstrual cycle (OR = 2.36, 95% CI = 1.31-4.26), <62>250 ml of tea consumption per day (OR = 4.73, 95% CI = 2.67-8.38), presence of vaginal infection (OR = 3.23, 95% CI = 1.85-5.62) and wiping back to front (OR = 2.52, 95% CI = 1.45-4.38). Along with the latter three, history of UTI in a first-degree female relative (OR = 10.88, 95% CI = 2.41-49.07), constipation (OR = 4.85, 95% CI = 1.97-11.92) and stress incontinence (OR = 2.45, 95% CI = 1.18-5.06) were additional independent risk factors for recurrent cystitis in comparison to healthy controls. Most of the risk factors for initial infection are potentially modifiable but sufficient to also pose risk for recurrence. Many of the findings reflect the cultural and ethnic practices in our country.

3 tables, 24 ref

000239   Mishra B;Manikanta A;Zamare D (Biotechnology Dep, Sreenidhi Institute of Science and Technology, Ghatkesar, Hyderabad-501 301, Email: mishra.bishwambhar@gmail.com) : Preparation of maltotriose syrup from microbial pullulan by sing pullulanase enzyme. Biosci Biotechnol Res Asia 2016, 13(1), 481-5.

The present work deals with the preparation and single point optimization of maltotriose syrup prepared from microbial pullulan. The enzyme pullulanase was used in this process for hydrolysis of pullulan. Production of pullulan was carried out in a shake flask fermenter with isopropanol precipitation. Various parameters like time, temperature, pH, amount of ethanol and effect of amount of enzyme on the hydrolysis of pullulan were optimized by single point optimization studies. The optimized values for the process parameters were 8h, 46°C, 5.5, 6 (v/v) and 10 ASPU/g for time of hydrolysis, temperature, pH, amount of ethanol and amount of pullulanase enzyme respectively. The results obtained from HPLC, confirmed that major component present in the hydrolysate were composed of maltotriose. Results of experiments indicated that this was a promising way of preparation of maltotriose.

8 illus, 17 ref

000238   Malthankar P A;Gujar G T (Entomology Div, Indian Agricultural Research Institute, New Delhi-110 012, Email: gtgujar@yahoo.com) : Toxicity of Bacillus thuringiensis cry2Ab and the inheritance of cry2Ab resistance in the pink bollworm, Pectinophora gossypiella (Saunders). Indian J expl Biol 2016, 54(9), 586-96.

Though the insecticidal crystal (Cry) proteins produced by Bacillus thuringiensis (Bt) are effective against insect pests, evolution of resistance remains an issue of great concern. Here, we explored the ability of pink bollworm, Pectinophora gossypiella (Lepidoptera: Gelechiidae), a key pest of cotton, to evolve resistance to Cry2Ab and characterized it in terms of inheritance. Sixteen day bioassay of Bt Cry2Ab toxin against 5-day old pink bollworm larvae showed median lethal concentration (LC₅₀) ranging 0.16-1.44 μg/g diet for five different populations collected from Srivilliputtur (Tamil Nadu), Jalgaon (Maharashtra), Bharuch (Gujarat), New Delhi (Delhi) and Sri Ganganagar (Rajasthan). Selection of pink bollworm for evolution of Cry2Ab resistance led to the maximal of 37.75-fold resistance vis-a-vis the most susceptible strain. Further studies on inheritance using above parental populations showed autosomal and semidominant nature of Cry2Ab resistance, with dominance h values of 0.69 and 0.79 for two reciprocal crosses. The inheritance of Cry2Ab resistance appeared to be governed by multiple alleles/genes. Cry2Ab resistance was associated with fitness costs in terms of prolonged larval and pupal period when resistant parent population was reared on the diet without toxin. Fitness cost in terms of larval period appeared to be inherited in F₁, F₂ and backcross progenies. F2 progeny also inherited these differences in larval and pupal periods. These studies clearly advocate rigorous monitoring of Cry2Ab resistance and compliance of resistance management in the pink bollworm for ensuring Bt cotton sustainability.

7 tables, 39 ref

000237   Liu H;Lin T;Zou Y;Shao J;Yang D;Li Q (Supervision & Testing Center for Farm Product Quality, Ministry of Agriculture, Institute of Quality Standard and Testing Tec, Kunming 650223, P.R. China, Email: cmliu_0@sina.com) : Ultrasound wave assisted-matrix solid phase extraction for determination of synthetic plant growth regulators residues in fruits and vegetables by ultra-high performance liquid chromatography. Asian J Chem 2015, 27(12), 4387-91.

An effective method using ultra-high performance liquid chromatography (UHPLC) was developed and optimized to obtain a complete separation of four representative synthetic plant growth regulators e.g., [2,4-dichlorophenoxyacetic acid (2,4-D), thidiazuron, forchlorfenuron and paclobutrazol] in fruits and vegetables. Extraction was performed with acetonitrile containing 0.5% (v/v) acetic acid + 5 g sodium chloride (pH 4) under 3 min with an ultrasound wave assisted bath (40 kHz, 50 W), then 2 mL organic extraction and 1 g sorbents mixed, purified, analyzed by UHPLC and HPLC. The performance of chromatography was assessed by UHPLC and HPLC. Good recoveries and relative standard deviation were found for all analytes in fruits and vegetables.

5 illus, 3 tables, 22 ref

000236   Lee S Y;Yan Y Z;Arasu M V;Al Dhabi N A;Park S U (Regional Innovation Center for Dental Science & Engineering, Chosun Univ, 309 Pilmun-daero, Dong-gu, Gwangju, Gwangju, 501-759, Korea, Email: supark@cnu.ac.kr) : Seasonal variation of saponin contents in Platycodon grandiflorum. Biosci Biotechnol Res Asia 2016, 13(1), 119-22.

The balloon flower (Platycodon grandiflorum A. DC) is well known as an ornamental plant and has been used as a vegetable and as a traditional medicinal plant over a long time period. The root parts of Platycodi Radix have rich quantities of saponin glycosides and other important phytochemical constituents. The present study aimed to investigate seasonal variation in saponin contents in P. Radix. Four important saponins-deapio-platycoside E, platycoside E, platycodin D3, and platyconic acid-were analyzed from the roots of balloon flower collected at different growing times. The contents of all of the analyzed saponins varied significantly with the time of growing. A similar trend of accumulation occurred for deapio-platycoside E and platycoside E. The highest concentrations of these two saponins were observed in August. The accumulation trends of platycodin D3 and platyconic acid in Platycodi Radix differed, in that the largest concentrations of these saponins were observed in May. Our results suggest that the time of harvest should take into consideration the accumulation of particular saponins, and that maximum accumulation of these compounds may occur in May or August.

1 illus, 21 ref